October 18, 2021

Proteins and miRNAs related to power metabolism


Protein inhibitor of activated STAT genes are differentially expressed in breast tumor tissues.

Goal: Protein inhibitor of activated STAT (PIAS) household consists of transcriptional regulator proteins with SUMO E3 ligase exercise. They regulate expression of a number of genes concerned in cell proliferation, differentiation and survival. 

Methodology: We evaluated expression of PIAS1-4 genes in 54 breast most cancers tissues and their paired adjoining noncancerous tissues. 

Outcomes:PIAS2 and PIAS3 genes had been considerably downregulated in tumoral tissues in contrast with adjoining noncancerous tissues. PIAS1-3 expressions had been considerably decrease in estrogen receptor (ER+) samples in contrast with ER- samples whereas PIAS4 had the other pattern. PIAS3 expression was considerably larger in grade 1 samples in contrast with grade 2 samples.

 Conclusion: These findings spotlight the position of PIAS genes within the pathogenesis of breast most cancers and their affiliation with determinants of response to antihormone therapies.

Dendritic Cell Focusing on of Bovine Viral Diarrhea Virus E2 Protein Expressed by Lactobacillus casei Successfully Induces Antigen-Particular Immune Responses by way of Oral Vaccination.

Bovine viral diarrhea brought on by bovine viral diarrhea virus (BVDV) is a vital illness in cattle, leading to important financial losses to the cattle business worldwide. With a purpose to develop an efficient vaccine towards BVDV an infection, we constructed a dendritic cell (DC)-targeting oral probiotic vaccine (pPG-E2-DCpep/LC W56) utilizing Lactobacillus casei as antigen supply provider to precise BVDV glycoprotein E2 fused with DC-targeting peptide, and the immunogenicity of orally administered probiotic vaccine was evaluated in mice mannequin.

 Our outcomes confirmed that after immunization with the probiotic vaccine, considerably ranges of antigen-specific sera IgG and mucosal sIgA antibodies (p < 0.05) with BVDV-neutralizing exercise had been induced in vivo. Problem experiment confirmed that pPG-E2-DCpep/LC W56 can present efficient immune safety towards BVDV, and BVDV may very well be successfully cleared from the gut of immunized mice post-challenge. Furthermore, the pPG-E2-DCpep/LC W56 may effectively activate DCs within the intestinal Peyer’s patches, and considerably ranges of lymphoproliferative responses,

 Th1-associated IFN-γ, and Th2-associated IL-Four had been noticed in mice immunized with pPG-E2-DCpep/LC W56 (p < 0.01). Our outcomes clearly demonstrate that the probiotic vaccine may effectively induce anti-BVDV mucosal, humoral, and mobile immune responses by way of oral immunization, indicating a promising technique for the event of oral vaccine towards BVDV.


Human Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Hu-48Tests 48 Tests
EUR 522

Human Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Hu-96Tests 96 Tests
EUR 724


DB-045-0.1 100 μl
EUR 212
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-045-0.2 200 μl
EUR 298
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-045-0.5 500 μl
EUR 384
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-045-1 1 ml
EUR 613
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-045-RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)


DB-045-RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)


DB045RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)


DB045RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Mouse Cluster Of Differentiation (CD163) ELISA Kit

DLR-CD163-Mu-48T 48T
EUR 508
  • Should the Mouse Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation (CD163) in samples from serum, plasma or other biological fluids.

Mouse Cluster Of Differentiation (CD163) ELISA Kit

DLR-CD163-Mu-96T 96T
EUR 661
  • Should the Mouse Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation (CD163) in samples from serum, plasma or other biological fluids.

Rat Cluster Of Differentiation (CD163) ELISA Kit

DLR-CD163-Ra-48T 48T
EUR 508
  • Should the Rat Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation (CD163) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Cluster Of Differentiation (CD163) ELISA Kit

DLR-CD163-Ra-96T 96T
EUR 661
  • Should the Rat Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation (CD163) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Mu-48Tests 48 Tests
EUR 511

Mouse Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Mu-96Tests 96 Tests
EUR 709

Rat Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Ra-48Tests 48 Tests
EUR 511

Rat Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Ra-96Tests 96 Tests
EUR 709

Mouse Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Mu-48Tests 48 Tests
EUR 534

Mouse Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Mu-96Tests 96 Tests
EUR 742

Rat Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Ra-48Tests 48 Tests
EUR 534

Rat Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Ra-96Tests 96 Tests
EUR 742

Anti-CD163 Antibody

A00812-1 100ug/vial
EUR 334

Anti-CD163 Antibody

PA1874 100ug/vial
EUR 294

Anti-CD163 Antibody

PA1874-1 100ug/vial
EUR 334

Anti-CD163 Antibody

STJ500423 100 µg
EUR 476

Anti-CD163 Antibody

STJ500424 100 µg
EUR 476

Anti-CD163 antibody

STJ110681 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.

Anti-CD163 antibody

STJ160082 1 mL C
EUR 941

Anti-CD163 antibody

STJ16100302 100 µg
EUR 720

Anti-CD163 antibody

STJ16100324 1 mL
EUR 979

Anti-CD163 antibody

STJ180301 0.1 ml
EUR 215

Anti-CD163 antibody

STJ190009 200 µl
EUR 197
Description: Unconjugated Mouse monoclonal to CD163 (AS1A1)

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

anti- CD163/M130 Antibody

FNab09771 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:300-1:1000
  • Immunogen: CD163
  • Uniprot ID: Q86VB7
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Neuroscience, Stem Cells
Description: Antibody raised against CD163/M130 

Anti-CD163/M130 Antibody

A00812 100ul
EUR 397
Description: Rabbit IgG polyclonal antibody for Scavenger receptor cysteine-rich type 1 protein M130 (CD163) detection.tested for IF, IHC, WB in Human, Mouse, Rat. Various direct flourescent conjugates are available for FCM upon request. Please contact us for details.

Anti-Hu CD163 Purified

11-645-C025 0.025 mg
EUR 99

Anti-Hu CD163 Purified

11-645-C100 0.1 mg
EUR 158

Anti-Hu CD163 APC

1A-645-T025 25 tests
EUR 140

Anti-Hu CD163 APC

1A-645-T100 100 tests
EUR 240

Anti-Hu CD163 PE

1P-645-T025 25 tests
EUR 140

Anti-Hu CD163 PE

1P-645-T100 100 tests
EUR 240

Anti-CD163/M130 antibody

PAab09771 100 ug
EUR 355

Anti-CD163 Antibody BIOTIN

STJ500425 100 µg
EUR 586

Anti-CD163 Antibody FITC

STJ500426 100 µg
EUR 586

Anti-CD163 Antibody BIOTIN

STJ500427 100 µg
EUR 586

Anti-CD163 Antibody FITC

STJ500428 100 µg
EUR 586

Human CD163 antigen(CD163)ISA kit

GA-E0263HM-48T 48T
EUR 289

Human CD163 antigen(CD163)ISA kit

GA-E0263HM-96T 96T
EUR 466

human CD163 antigen,CD163 LISA kit

201-12-0247 96 tests
EUR 440
  • This CD163 antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human CD163 antigen(CD163)ISA kit

QY-E05066 96T
EUR 361

Mouse Anti Human Cd163 Monoclonal Antibody

CABT-47162MH 25 µg
EUR 372

Mouse Anti Human Cd163 Monoclonal Antibody

CABT-47163MH 0.2 mg
EUR 881

Anti-CD163 Rabbit Monoclonal Antibody

M00812 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD163 Antibody. Validated in IP, WB and tested in Human.

Anti-Hu CD163 PE-Cy7

T7-645-T025 25 tests
EUR 154

Anti-Hu CD163 PE-Cy7

T7-645-T100 100 tests
EUR 268

Anti-Hu CD163 PerCP-Cy5.5

T9-645-T025 25 tests
EUR 196

Anti-Hu CD163 PerCP-Cy5.5

T9-645-T100 100 tests
EUR 352

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Porcine CD163 antigen,CD163 LISA kit

GA-E0045PC-48T 48T
EUR 364

Porcine CD163 antigen,CD163 LISA kit

GA-E0045PC-96T 96T
EUR 590

Canine CD163 antigen(CD163 LISA kit

GA-E0062CN-48T 48T
EUR 402

Canine CD163 antigen(CD163 LISA kit

GA-E0062CN-96T 96T
EUR 684

Mouse Anti Rat Cd163 Monoclonal Antibody

DMABT-47170MR 0.25 mg
EUR 741

Mouse Anti Rat Cd163 Monoclonal Antibody

DMABT-47171MR 0.1 mg
EUR 559

CD163 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD163 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD163 Antibody

  • EUR 467.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 1-2 weeks.

CD163 Antibody

ABD8235 100 ug
EUR 438

CD163 Antibody

37157-100ul 100ul
EUR 252

CD163 Antibody

49553-100ul 100ul
EUR 333

CD163 Antibody

49553-50ul 50ul
EUR 239

CD163 antibody

10R-6496 100 ug
EUR 203
Description: Mouse monoclonal CD163 antibody

CD163 antibody

10R-CD163aRT 250 ug
EUR 716
Description: Mouse monoclonal CD163 antibody

CD163 Antibody

DF8235 200ul
EUR 304
Description: CD163 Antibody detects endogenous levels of total CD163.

CD163 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CD163 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Cd163 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd163. Recognizes Cd163 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

Mouse Anti-Human CD163 monoclonal antibody, clone JID274

CABT-L2938-100uL500uL 100 uL, 500 uL
EUR 502

Anti-Human CD163 DyLight® 488 conjugated Antibody

A00812-Dyl488 100ug/vial
EUR 344

Anti-Human CD163 DyLight® 550 conjugated Antibody

A00812-Dyl550 100ug/vial
EUR 344

Human CD163 ELISA Kit

ELA-E1726h 96 Tests
EUR 824

Human CD163 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CD163 ELISA Kit

LF-EK50890 1×96T
EUR 648

Human CellExp? CD163, Human recombinant

EUR 305

Human CellExp? CD163, Human recombinant

EUR 773

Mouse Anti Pig Cd163 Monoclonal Antibody,FITC

CABT-47164MP 0.1 mg
EUR 881

Mouse Anti Pig Cd163 Monoclonal Antibody,RPE

CABT-47166MP 100 TEST
EUR 715

Mouse Anti Rat Cd163 Monoclonal Antibody,Biotin

DMABT-47168MR 0.1 mg
EUR 881

Mouse Anti Rat Cd163 Monoclonal Antibody,FITC

DMABT-47169MR 0.1 mg
EUR 881

Mouse Anti Rat Cd163 Monoclonal Antibody,RPE

DMABT-47172MR 100 TEST
EUR 892

Anti-CD163 Rabbit Monoclonal Antibody, Clone#RM371

M00812-1 100uL
EUR 385
Description: Anti-CD163 Rabbit Monoclonal Antibody, Clone#RM371 tested in WB, IHC, reactive to Human

CD163 Conjugated Antibody

C37157 100ul
EUR 397

CD163 Conjugated Antibody

C49553 100ul
EUR 397

Porcine CD163 Protein

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

Cd163 Polyclonal Antibody

A53832 100 µg
EUR 570.55
Description: Ask the seller for details

Differentially expressed mRNAs, proteins and miRNAs related to power metabolism in skeletal muscle of beef cattle recognized for high and low residual feed consumption.

Feed effectivity is among the most necessary parameters that have an effect on beef manufacturing prices. The power metabolism of skeletal muscle significantly contributes to variations in feed effectivity. Nonetheless, data concerning variations in proteins concerned within the power metabolism of the skeletal muscle in beef cattle divergently recognized for feed effectivity is scarce.

On this research, we aimed to analyze power metabolism of skeletal muscle of Nellore beef cattle, recognized for high and low residual feed consumption utilizing a proteomics strategy. We additional assessed the expression of candidate microRNAs as a one of many doable mechanisms controlling the biosynthesis of the proteins concerned in power metabolism that had been differentially considerable between excessive and low residual feed consumption animals.A better abundance of 14-3-Three protein epsilon (P = 0.01) was noticed in skeletal muscle of residual feed consumption (RFI) excessive animals (RFI-Excessive).

Conversely, a better abundance of Warmth Shock Protein Beta 1 (P < 0.01) was noticed within the skeletal muscle of RFI-Low cattle. A better mRNA expression of YWHAE, which encodes the 14-3-Three protein epsilon, was additionally noticed within the skeletal muscle of RFI-Excessive animals (P = 0.01).

A decrease mRNA expression of HSPB1, which encodes the Warmth Shock Protein Beta 1, was noticed within the skeletal muscle of RFI-Excessive animals (P = 0.01). The miR-665 was recognized as a possible regulator of the 14-3-Three protein epsilon, and its expression was better in RFI-Low animals (P < .001).

A better expression of miR-34a (P = 0.01) and miR-2899 (P < .001) was noticed within the skeletal muscle of RFI-Excessive animals, as each miRNAs had been recognized as potential regulators of HSPB1 expression.Our outcomes present that Nellore cattle divergently recognized for feed effectivity by RFI current adjustments within the abundance of proteins concerned in power expenditure in skeletal muscle.

 Furthermore, our knowledge level in the direction of that miR-665, miR34a and miR-2899 are seemingly concerned in controlling each 14-3-Three epsilon and HSPB1 proteins recognized as differentially considerable within the skeletal muscle of RFI-Excessive and RFI-Low Nellore cattle.

GRO / KC (CXCL1) Protein

  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO1/KC Mouse Recombinant Protein (CXCL1)

PROTP12850-1 Regular: 20ug
EUR 317
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.

Recombinant Mouse (E.Coli) GRO/KC (CXCL1)

RP-1037 5 ug
EUR 164

GRO/KC (CXCL1), Rat Recombinant

EUR 370

GRO/KC (CXCL1), Rat Recombinant

EUR 175

Recombinant Murine KC (CXCL1) Protein

PROTP12850-2 20ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

GRO, KC, CXCL1, rRtGRO, rat

RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag

PROTP12850 Regular: 20ug
EUR 317
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)

RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Rat GRO/KC (CXCL1) Protein

PROTP14095-1 25ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.


RK00196 96 Tests
EUR 521

KC protein (Mouse)

30R-AK001 20 ug
EUR 273
Description: Purified recombinant Mouse KC protein

Anti-CXCL1 antibody

STJ28366 100 µl
EUR 277
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.

Anti-CXCL1 antibody

STJ72026 100 µg
EUR 260

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Rabbit Anti Mouse Cxcl1 Polyclonal Antibody

CPBT-65100RM 0.1 mg
EUR 881

KC antibody

20R-1786 100 ug
EUR 651
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12297 100 ug
EUR 527
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12298 100 ug
EUR 492
Description: Rabbit polyclonal KC antibody

KC Antibody

EUR 376

KC Antibody

EUR 392

KC Antibody

EUR 146

KC antibody

70R-KR006 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal KC antibody

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90006 20 ug
EUR 1025
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90007 100 ug
EUR 2725
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

Anti-GRO alpha/Cxcl1 Antibody

A00533 100ug/vial
EUR 294

Anti-GRO alpha/CXCL1 Antibody

PA1760 100ug/vial
EUR 294

KC Blocking Peptide

33R-11041 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298

KC Blocking Peptide

EUR 153

Polyclonal KC Antibody

APR16969G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:

KC 12291 hydrochloride

B7332-10 10 mg
EUR 373

KC 12291 hydrochloride

B7332-50 50 mg
EUR 1363


55R-1741 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

Mouse CXCL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRO-alpha/CXCL1, Mouse

HY-P7188 50ug
EUR 533

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CXCL1 protein

30R-3156 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein

CXCL1 antibody

70R-16681 50 ul
EUR 435
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-10502 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-14297 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-15473 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 Antibody

33054-100ul 100ul
EUR 252

CXCL1 Antibody

43679-100ul 100ul
EUR 252

CXCL1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CXCL1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Cxcl1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA


E21-597 10ug
EUR 343


EF012822 96 Tests
EUR 689

CXCL1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT10178 2 ug
EUR 301

Rabbit Anti Rat Cxcl1 Polyclonal Antibody

CPBT-65101RR 0.1 mg
EUR 881

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

KiloGreen 2X qPCR MasterMix-iCycler

MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140

GRO/KC, murine recombinant

EUR 773

GRO/KC, murine recombinant

EUR 3856

GRO/KC, murine recombinant

EUR 256

Mouse CXCL1 Detection Assay Kit

6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit

CXCL1 protein (Mouse) (His tag)

80R-3368 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

CXCL1 protein (Mouse) (His tag)

80R-3439 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

ELISA kit for Mouse CXCL1

EK5299 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse CXCL1 PicoKine ELISA Kit

EK0723 96 wells
EUR 456
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.

Mouse CXCL1/GROα ELISA kit

LF-EK50473 1×96T
EUR 648

Cxcl1 ORF Vector (Mouse) (pORF)

ORF042286 1.0 ug DNA
EUR 95

CXCL1 ELISA Kit (Mouse) (OKAN04583)

OKAN04583 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL

CXCL1 ELISA Kit (Mouse) (OKBB00312)

OKBB00312 96 Tests
EUR 544
Description: Description of target: Chemokine (C-X-C motif) ligand 1 (CXCL1) is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GROα, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-α). In humans, this protein is encoded by the CXCL1 gene. The gene for CXCL1 is located on human chromosome 4 amongst genes for other CXC chemokines. The mature form of CXCL1 is maximally 73 amino acids long. CXCL1 is secreted by human melanoma cells, has mitogenic properties and is implicated in melanoma pathogenesis. CXCL1 is expressed by macrophages, neutrophils and epithelial cells, and has neutrophil chemoattractant activity. This chemokine elicits its effects by signaling through the chemokine receptor CXCR2.CXCL1 decreased the severity of multiple sclerosis and may offer a neuro-protective function. The standard product used in this kit is recombinant mouse CXCL1, consisting of 77 amino acids with the molecular mass of 8KDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml

CXCL1 ELISA Kit (Mouse) (OKCD05712)

OKCD05712 96 Wells
EUR 609
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL

KC ELISA Kit (Mouse) : 96 Wells (OKAG00090)

OKAG00090 96 Wells
EUR 596
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 8 pg/mL

CXCL1 Blocking Peptide

33R-7741 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502

CXCL1 antibody (HRP)

60R-2236 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (HRP)

CXCL1 antibody (FITC)

60R-2237 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (FITC)

CXCL1 antibody (biotin)

60R-2238 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (biotin)

CXCL1 Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CXCL1 Conjugated Antibody

C33054 100ul
EUR 397

CXCL1 cloning plasmid

CSB-CL006239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.

Cxcl1 Polyclonal Antibody

A51950 100 µg
EUR 570.55
Description: fast delivery possible

CXCL1 Polyclonal Antibody

A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research

Recombinant Human CXCL1

P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1


PVT13291 2 ug
EUR 391

Mouse CXCL1 AssayLite Antibody (FITC Conjugate)

70027-05141 150 ug
EUR 428

Mouse Growth-regulated alpha protein (Cxcl1)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli

GRO-alpha/CXCL1 (CHO-expressed), Mouse

HY-P7186 50ug
EUR 337

Cxcl1 sgRNA CRISPR Lentivector set (Mouse)

K4368201 3 x 1.0 ug
EUR 339

Mouse CXCL1/GROα ELISA kit (4X96T)

LF-EK50474 4×96T
EUR 2201


55R-1740 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory


55R-1742 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory