Characterization of differentially expressed plasma proteins in sufferers

Prediction of Radioresistant Prostate Most cancers Primarily based on Differentially Expressed Proteins

Introduction: 

Though relapses after radiotherapy are widespread in prostate most cancers (PCA) sufferers, these with a excessive threat for radioresistance can’t be recognized previous to remedy but. Due to this fact, this proof-of-concept examine was carried out to check protein expression profiles of sufferers with radio-recurrent PCA to sufferers handled with major radical prostatectomy separated by Gleason threat teams. We hypothesized that radio-recurrent PCA have an identical protein expression as high-risk Gleason PCA.

Strategies:

Affected person cohorts consisted of (i) 31 sufferers handled with salvage prostatectomy for regionally recurrent PCA after major radiotherapy and (ii) 94 sufferers handled with major prostatectomy break up right into a Gleason high-risk (≥4 + 3; n = 42 [44.7%]) versus a low-risk group (≤3 + 4; n = 52 [55.3%]). Immunohistochemistry was carried out utilizing 15 antibodies with identified affiliation to radioresistance in PCA in vitro. ELISA was used for validation of chosen markers in serum.

Outcomes: 

Androgen receptor (AR) was overexpressed in most radio-recurrent PCA (89.7%) and in most major high-risk Gleason PCA (87.8%; p = 0.851), whereas solely 67.3% of the low-risk group confirmed an expression (p = 0.017). Contemplating the best Gleason sample in major PCA, aldo-keto reductase household 1 member C3 (AKR1C3) was most equally expressed by sufferers with radio-recurrent PCA and sufferers with Gleason patterns Four and 5 (p = 0.827 and p = 0.893) in comparison with Gleason sample 3 (p = 0.20). These findings have been supported by ELISA.

Conclusion:

That is the primary examine to judge protein markers in an effort to predict radioresistance in PCA. Our outcomes level to AR and AKR1C3 as probably the most promising markers which may assist stratify sufferers for radiotherapy.

The ribotoxin-like protein Ostreatin from Pleurotus ostreatus fruiting our bodies: Affirmation of a novel ribonuclease household expressed in basidiomycetes

Fungi produce a number of toxins lively towards vegetation, animal or people. Amongst them, ribotoxins are enzymes that particularly assault ribosomes irreparably compromising protein synthesis, helpful as pesticides or as anticancer brokers. Right here, a novel ribotoxin from the edible mushroom Pleurotus ostreatus has been purified and characterised.

This ribotoxin, named Ostreatin, is a selected ribonuclease releasing α-fragment when incubated with yeast or rabbit ribosomes. Ostreatin reveals IC₅₀ of 234 pM in rabbit reticulocyte lysate, and steel dependent endonuclease exercise.

Following the completion of Ostreatin major construction, we ascertained that this toxin is homologous to Ageritin, the primary ribotoxin-like protein from the basidiomycete Agrocybe aegerita, with which it shares 38.8% amino acid sequence id.

 Ostreatin consists of 131 amino acid residues with an experimental molecular mass of 14,263.51 Da ([M+H⁺]⁺). Homology modeling revealed that Ostreatin and Ageritin share an identical fold through which the widespread catalytic triad is conserved.

Purified Ostreatin lacks N-terminal and C-terminal peptides, which as an alternative are current within the Ostreatin coding sequence. Such peptides are in all probability concerned in protein sorting and for this they may very well be eliminated. Our findings affirm the presence of ribotoxin-like proteins in basidiomycetes edible mushrooms, that we suggest as novel device for biotechnological purposes.

Human CCL-5 ELISA Kit
EHC0240	Abclonal	96Tests	EUR 521

AXYGEN® HORIZONTAL GEL BOX, 15 CM
HGB-15	CORNING	1/pk	EUR 486
Description: Lab Equipment; Axygen Branded EQ

DiagNano Fluorophore Labeled Gold Nanoparticles, 15 nm
GFL-15	Creative Diagnostics	1 mL	EUR 1053

AXYGEN® GEL TRAY 15 X 15 CM FOR USE WITH 15 CM GEL BOX, UV TRANSPARENT
HGB15-15-GT	CORNING	1/pk	EUR 79
Description: Lab Equipment; Axygen Branded EQ

DiagNano Gold Nanoparticle Passive Conjugation Kit, 15 nm
GPK-15	Creative Diagnostics	1 kit	EUR 715

Anti-Human IgG
DB173RTU-15	DB Biotech	15 ml	EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB174RTU-15	DB Biotech	15 ml	EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Goat CCL-5 ELISA Kit
EGTC0240	Abclonal	96Tests	EUR 521

Canine CCL-5 ELISA Kit
ECC0240	Abclonal	96Tests	EUR 521

Chicken CCL-5 ELISA Kit
ECKC0240	Abclonal	96Tests	EUR 521

Bovine CCL-5 ELISA Kit
EBC0240	Abclonal	96Tests	EUR 521

Anserini CCL-5 ELISA Kit
EAC0240	Abclonal	96Tests	EUR 521

Porcine CCL-5 ELISA Kit
EPC0240	Abclonal	96Tests	EUR 521

Rat CCL-5 ELISA Kit
ERC0240	Abclonal	96Tests	EUR 521

Rabbit CCL-5 ELISA Kit
ERTC0240	Abclonal	96Tests	EUR 521

Sheep CCL-5 ELISA Kit
ESC0240	Abclonal	96Tests	EUR 521

Mouse CCL-5 ELISA Kit
EMC0240	Abclonal	96Tests	EUR 521

Monkey CCL-5 ELISA Kit
EMKC0240	Abclonal	96Tests	EUR 521

Anti-Human Kappa Light Chain
DB037RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human Kappa Light Chain
DB038RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human Lambda Light Chain
DB039RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Guinea Pig CCL-5 ELISA Kit
EGC0240	Abclonal	96Tests	EUR 521

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

Anti-iNOS
DB003RTU-15	DB Biotech	15 ml	EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-p53
DB026RTU-15	DB Biotech	15 ml	EUR 338
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD5
DB027RTU-15	DB Biotech	15 ml	EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD20
DB041RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD45
DB042RTU-15	DB Biotech	15 ml	EUR 338
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD163
DB045RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Melanosome
DB049RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD10
DB057RTU-15	DB Biotech	15 ml	EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD117
DB062RTU-15	DB Biotech	15 ml	EUR 338
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD1a
DB071RTU-15	DB Biotech	15 ml	EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD3
DB082RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD8
DB085RTU-15	DB Biotech	15 ml	EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-EGFR
DB092RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD7
DB114RTU-15	DB Biotech	15 ml	EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-MSH2
DB115RTU-15	DB Biotech	15 ml	EUR 400
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-p63
DB134RTU-15	DB Biotech	15 ml	EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD23
DB135RTU-15	DB Biotech	15 ml	EUR 429
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Desmin
DB148RTU-15	DB Biotech	15 ml	EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD34
DB151RTU-15	DB Biotech	15 ml	EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-p16
DB152RTU-15	DB Biotech	15 ml	EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Synaptophysin
DB156RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Braf
DB159RTU-15	DB Biotech	15 ml	EUR 709
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-p60
DB203RTU-15	DB Biotech	15 ml	EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

anti-Cytokeratin 15
YF-PA12886	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to Cytokeratin 15

anti-Cytokeratin 15
YF-PA12887	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Cytokeratin 15

anti-Calpain 15
YF-PA24745	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Calpain 15

anti-Claudin 15
YF-PA18066	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Claudin 15

anti-Claudin 15
YF-PA18067	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Claudin 15

anti-Kallikrein 15
YF-PA19752	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Kallikrein 15

DiagNano Fluorophore Labeled Gold Nanoparticles, 15 nm, Cellular Uptake
GFL-15-CU	Creative Diagnostics	1mL	EUR 1365

DiagNano Gold Nanoparticle Medium Covalent Conjugation Kit, 15 nm
GCK-M-15	Creative Diagnostics	1 kit	EUR 757

Anti-Human GCDFP-15 antibody
STJ16100371	St John's Laboratory	1 mL	EUR 956

Anti-b-actin
DB001RTU-15	DB Biotech	15 ml	EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Melan A
DB050RTU-15	DB Biotech	15 ml	EUR 302
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 7
DB051RTU-15	DB Biotech	15 ml	EUR 309
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-S-100
DB055RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cyclin D1
DB066RTU-15	DB Biotech	15 ml	EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Ki-67
DB070RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-TTF-1
DB089RTU-15	DB Biotech	15 ml	EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 8
DB098RTU-15	DB Biotech	15 ml	EUR 309
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 14
DB099RTU-15	DB Biotech	15 ml	EUR 302
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 16
DB100RTU-15	DB Biotech	15 ml	EUR 302
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 17
DB101RTU-15	DB Biotech	15 ml	EUR 302
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 18
DB102RTU-15	DB Biotech	15 ml	EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 19
DB103RTU-15	DB Biotech	15 ml	EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-C3d complement
DB106RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-C4d complement
DB107RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Ki-67
DB111RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 20
DB119RTU-15	DB Biotech	15 ml	EUR 309
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Chromogranin A
DB158RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-P504S (AMACR)
DB208RTU-15	DB Biotech	15 ml	EUR 340
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-ER (Estrogen Receptor)
DB053RTU-15	DB Biotech	15 ml	EUR 406
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-PR (Progesterone Receptor)
DB059RTU-15	DB Biotech	15 ml	EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-EBV/LMP-1
DB060RTU-15	DB Biotech	15 ml	EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-EBV/LMP-1
DB061RTU-15	DB Biotech	15 ml	EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 5/6
DB097RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-PR (Progesterone Receptor)
DB108RTU-15	DB Biotech	15 ml	EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-PR (Progesterone Receptor)
DB109RTU-15	DB Biotech	15 ml	EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-p16 (mouse monoclonal)
DB253RTU-15	DB Biotech	15 ml	EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-PLAP (Placental Alkaline Phosphatase)
DB047RTU-15	DB Biotech	15 ml	EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-EMA (CD227, Mucin-1)
DB048RTU-15	DB Biotech	15 ml	EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Alpha Smooth Muscle Actin
DB147RTU-15	DB Biotech	15 ml	EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

anti- Cytokeratin 15 antibody
FNab02198	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: keratin 15 Uniprot ID: P19012 Gene ID: 3866 Research Area: Cancer, Immunology
Description: Antibody raised against Cytokeratin 15

anti- Cytokeratin 15 antibody
FNab02199	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IF: 1:10-1:100 Immunogen: keratin 15 Uniprot ID: P19012 Gene ID: 3866 Research Area: Cancer, Immunology
Description: Antibody raised against Cytokeratin 15

Anti-MMP-15 Antibody
A06396	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MMP-15 Antibody. Validated in WB and tested in Human, Mouse.

Anti-DHHC-15 Antibody
A12099	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for DHHC-15 Antibody (ZDHHC15) detection. Tested with WB in Human.

Anti-Cytokeratin 15 Antibody
A06791	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Cytokeratin 15 Antibody (KRT15) detection.tested for WB in Human, Mouse, Rat, Monkey.

Anti-Cytokeratin 15 antibody
PAab02198	Lifescience Market	100 ug	EUR 355

anti-CDC2 (Ab-15)
LF-PA20070	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to CDC2

anti-HSP27 (Ab-15)
LF-PA20219	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to HSP27

anti-p53 (Ab-15)
LF-PA20358	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to p53

Anti-Cytokeratin 15 antibody
STJ92628	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Cytokeratin 15.

Anti-DHHC-15 antibody
STJ92707	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to DHHC-15.

Anti-GDF-15 antibody
STJ93253	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to GDF-15.

Anti-MMP-15 antibody
STJ94276	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to MMP-15.

Anti-PEA-15 antibody
STJ95018	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to PEA-15.

Anti-PEA-15 antibody
STJ95019	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to PEA-15.

Anti-PEA-15 antibody
STJ95020	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to PEA-15.

Anti-BMP-15 antibody
STJ97345	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to BMP-15.

Anti-Cytokeratin 15 antibody
STJ97982	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Cytokeratin 15.

Anti-IL-15 antibody
STJ99006	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to IL-15.

Anti-GCDFP-15 antibody
STJ16100370	St John's Laboratory	1 mL	EUR 813

Anti-GCDFP-15 antibody
STJ180109	St John's Laboratory	0.1 ml	EUR 213

Anti-GCDFP-15 antibody
STJ180290	St John's Laboratory	0.1 ml	EUR 212

Anti-CK-15 antibody
STJ190030	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Mouse monoclonal to CK-15 (5A1)

Anti-Calpain 15 (4E2)
YF-MA15522	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Calpain 15

Anti-Calpain 15 (2H7)
YF-MA15523	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Calpain 15

anti-15 Lipoxygenase 1
YF-PA10168	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to 15 Lipoxygenase 1

anti-Protease Inhibitor 15
YF-PA18816	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Protease Inhibitor 15

Anti-GDF-15 Antibody
A2038-100	Biovision	100 µl	EUR 419

TruStrip Sample Transfer Strips, 15-ul, 50/Pk (without sample tracking dye)
STS-15-50	Alpha Diagnostics	1 Pk	Ask for price

TruStrip Sample Transfer Strips, 15-ul, 50/Pk (with sample tracking dye)
STSD-15-50	Alpha Diagnostics	1 Pk	Ask for price

Anti-Human IgG
DB-173-RTU-15	DB Biotech	15 ml	EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Characterization of differentially expressed plasma  proteins in sufferers with acute myocardial infarction

Acute myocardial infarction (AMI) stays a number one reason behind morbidity and mortality worldwide. Novel biomarkers are wanted to determine NSTEMI in AMI sufferers. The examine goal was to make use of proteomics to determine novel plasma biomarkers for STEMI and NSTEMI sufferers. iTRAQ evaluation was carried out on pooled samples from Eight wholesome controls and 12 STEMI and 12 NSTEMI sufferers.

 Bioinformatics evaluation recognized 95 differentially expressed proteins that have been differentially expressed within the plasma of AMI sufferers and wholesome controls; 28 of those proteins have been present in STEMI/Con (22 upregulated and 6 downregulated), 48 in NSTEMI/Con (12 upregulated and 36 downregulated), and 44 in NSTEMI/STEMI (11 upregulated and 33 downregulated).

• Protein community evaluation was then carried out utilizing STRING software program. Practical evaluation revealed that the recognized plasma proteins have been primarily concerned with carbon metabolism, toll-like receptor signaling pathway, and hypertrophic cardiomyopathy.
  
• 9 of the proteins (SSA1, MDH1, FCN2, GPI, S100A8, LBP, vinculin, VDBP, and RBP4) that modified ranges throughout AMI development have been additional validated by ELISA. The constructed plasma proteome may replicate the AMI pathogenesis molecular mechanisms and supply a technique for the early identification of NSTEMI in AMI sufferers. SIGNIFICANCE:

The purpose of this examine was to make use of proteomics to determine novel predictive plasma biomarkers for sufferers with acute myocardial infarction (AMI), which might enable for both identification of people susceptible to an infarction, and early identification of NSTEMI in sufferers with AMI. Utilizing an strategy that mixed iTRAQ with LC-MS/MS, we discovered 95 proteins that confirmed vital variations in expression ranges among the many AMI sufferers and wholesome controls.

The proteins SSA1, MDH1, FCN2, GPI, S100A8, LBP, vinculin, VDBP, and RBP4 have been discovered to play essential roles within the pathogenesis of AMI. Utilizing bioinformatics evaluation, we discovered that dysregulation of carbon metabolism, toll-like receptor signaling pathway, and hypertrophic cardiomyopathy will be the main driving forces for cardiac injury throughout myocardial infarction.

Nonetheless, additional investigations are wanted to confirm the mechanisms concerned within the growth of AMI particularly NSTEMI. Taken collectively, our findings lay the inspiration for understanding the molecular mechanisms underlying the pathogenic processes of AMI, and counsel potential purposes for particular biomarkers in early prognosis and willpower of prognosis.

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Human KIR2DL4 ELISA KIT
ELI-21303h	Lifescience Market	96 Tests	EUR 824

Human KIR2DL4 shRNA Plasmid
20-abx952576	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KIR2DL4 Recombinant Protein (Human)
RP017041	ABM	100 ug	Ask for price

KIR2DL4 Rabbit pAb
A12836-100ul	Abclonal	100 ul	EUR 308

KIR2DL4 Rabbit pAb
A12836-200ul	Abclonal	200 ul	EUR 459

KIR2DL4 Rabbit pAb
A12836-20ul	Abclonal	20 ul	EUR 183

KIR2DL4 Rabbit pAb
A12836-50ul	Abclonal	50 ul	EUR 223

KIR2DL4 Blocking Peptide
33R-9831	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIR2DL4 antibody, catalog no. 70R-2365

KIR2DL4 Polyclonal Antibody
27806-100ul	SAB	100ul	EUR 252

KIR2DL4 Polyclonal Antibody
27806-50ul	SAB	50ul	EUR 187

KIR2DL4 cloning plasmid
CSB-CL857457HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1134 Sequence: atgtccatgtcacccacggtcatcatcctggcatgtcttgggttcttcttggaccagagtgtgtgggcacacgtgggtggtcaggacaagcccttctgctctgcctggcccagcgctgtggtgcctcaaggaggacacgtgactcttcggtgtcactatcgtcgtgggtttaaca Show more
Description: A cloning plasmid for the KIR2DL4 gene.

pOTB7-KIR2DL4 Plasmid
PVTB00348	Lifescience Market	2 ug	EUR 356

KIR2DL4 ORF Vector (Human) (pORF)
ORF005681	ABM	1.0 ug DNA	EUR 95

KIR2DL4 Polyclonal Conjugated Antibody
C27806	SAB	100ul	EUR 397

pEGFP-flag-KIR2DL4 Plasmid
PVTB00348-2a	Lifescience Market	2 ug	EUR 356

KIR2DL4 sgRNA CRISPR Lentivector set (Human)
K1150301	ABM	3 x 1.0 ug	EUR 339

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody
20-abx339417	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody
20-abx210854	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody
1-CSB-PA246816	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody
1-CSB-PA205578	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)
C310-10ug	Novoprotein	10ug	EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)
C310-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)
C310-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)
C310-50ug	Novoprotein	50ug	EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1150302	ABM	1.0 ug DNA	EUR 154

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1150303	ABM	1.0 ug DNA	EUR 154

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1150304	ABM	1.0 ug DNA	EUR 154

Recombinant Human KIR2DL4 Protein, His, Insect-1ug
QP12489-1ug	EnQuireBio	1ug	EUR 155

Recombinant Human KIR2DL4 Protein, His, Insect-50ug
QP12489-50ug	EnQuireBio	50ug	EUR 1261

Recombinant Human KIR2DL4 Protein, His, Insect-5ug
QP12489-5ug	EnQuireBio	5ug	EUR 201

KIR2DL4 Protein Vector (Human) (pPB-C-His)
PV022721	ABM	500 ng	EUR 329

KIR2DL4 Protein Vector (Human) (pPB-N-His)
PV022722	ABM	500 ng	EUR 329

KIR2DL4 Protein Vector (Human) (pPM-C-HA)
PV022723	ABM	500 ng	EUR 329

KIR2DL4 Protein Vector (Human) (pPM-C-His)
PV022724	ABM	500 ng	EUR 329

KIR2DL4 3'UTR Luciferase Stable Cell Line
TU011796	ABM	1.0 ml	EUR 1521

KIR2DL4 3'UTR GFP Stable Cell Line
TU061796	ABM	1.0 ml	EUR 1521

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1150305	ABM	3 x 1.0 ug	EUR 376

Killer Cell Immunoglobulin-Like Receptor 2DL4 (KIR2DL4) Antibody
abx145740-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1150306	ABM	1.0 ug DNA	EUR 167

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1150307	ABM	1.0 ug DNA	EUR 167

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1150308	ABM	1.0 ug DNA	EUR 167

KIR2DL4 Killer Cell Immunoglobulin-Like Receptor, 2 Domains Long Cytoplasmic Tail 4 Human Recombinant Protein
PROTQ99706	BosterBio	Regular: 5ug	EUR 317
Description: KIR2DL4 Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 458 amino acids (24-242 a.a.) and having a molecular mass of 51kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). KIR2DL4 is expressed with a 239 amino acids hIgG-His tag at C-Terminus and purified by proprietary chromatographic techniques.

anti-human RecQL4
AR05-PA0007	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to human RecQL4

anti-human CCR1
20R-3028	Fitzgerald	200 ug	EUR 587
Description: Goat anti-human CCR1 antibody

Anti-Human IgG
DB-173-0.1	DB Biotech	100 μl	EUR 212
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-173-0.2	DB Biotech	200 μl	EUR 298
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-173-0.5	DB Biotech	500 μl	EUR 384
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-173-1	DB Biotech	1 ml	EUR 613
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-173-RTU-15	DB Biotech	15 ml	EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB-173-RTU-7	DB Biotech	7 ml	EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB-174-0.1	DB Biotech	100 μl	EUR 212
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-174-0.2	DB Biotech	200 μl	EUR 298
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-174-0.5	DB Biotech	500 μl	EUR 384
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-174-1	DB Biotech	1 ml	EUR 613
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-174-RTU-15	DB Biotech	15 ml	EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB-174-RTU-7	DB Biotech	7 ml	EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB173RTU-15	DB Biotech	15 ml	EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB173RTU-7	DB Biotech	7 ml	EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB174RTU-15	DB Biotech	15 ml	EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB174RTU-7	DB Biotech	7 ml	EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

anti-human Albumin
LF-PA10001	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to human Albumin

Goat anti-Human anti-thrombin polyclonal antibody
CABT-L487	Creative Diagnostics	500ug	EUR 715

Sheep anti-Human anti-thrombin polyclonal antibody
CABT-L488	Creative Diagnostics	500ug	EUR 663

Sheep anti-Human anti-thrombin polyclonal antibody
CABT-L489	Creative Diagnostics	100ug	EUR 663

Sheep anti-Human anti-thrombin polyclonal antibody
CABT-L490	Creative Diagnostics	100ug	EUR 663

Sheep anti-Human anti-thrombin polyclonal antibody
CABT-L491	Creative Diagnostics	100ug	EUR 663

Human anti-TPO(anti-thrombopoietin) ELISA Kit
EH4147	FN Test	96T	EUR 524.1
Detection range: 1.563-100 ng/ml Alias: anti-TPO
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens ;Sensitivity: 0.938 ng/ml

Human anti AMPH(anti amphiphysin) ELISA Kit
EH2621	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: P49418 Alias: anti-AMPH
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *
V100125	AAT Bioquest	50 ug	EUR 306
R-phrase: H-Phrase: Symbol for dangerous compounds: UNSPEC Code:

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *
V100126	AAT Bioquest	1 mg	EUR 393
R-phrase: H-Phrase: Symbol for dangerous compounds: UNSPEC Code:

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
4-AEA465Hu	Cloud-Clone	EUR 5698.00 EUR 3011.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies Sperm Antibodies Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)
ELK8071	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat Anti-Human IgA
C020242-1mg	Unibiotest	1mg	EUR 227

Goat Anti-Human IgA
C020242-50mg	Unibiotest	50mg	EUR 2635

Rabbit Anti Human IgG
E61I00101	EnoGene	100ug	EUR 343

Goat Anti Human IgG
E61I00201	EnoGene	1mg	EUR 274

Goat Anti Human IgM
E61I00401	EnoGene	100ug	EUR 343

Mouse Anti Human IgM
E61I00402	EnoGene	100ug	EUR 343

Goat anti human IgA
E61I01201	EnoGene	1mg	EUR 611

Mouse anti human IgA
E61I02101	EnoGene	100ug	EUR 343

Goat anti human IgA
E61I02102	EnoGene	100ug	EUR 343

Mouse anti human IgE
E61I02201	EnoGene	100ug	EUR 343

Anti-Human IgG:HRP Conjugate
F163	Cygnus Technologies	12 ml	EUR 488
Product category: Antibodies
Description: Anti-Human IgG:HRP Conjugate by Cygnus Technologies is available in Europe via Gentaur.

Goat anti- human IgA
FNab09895	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:10000 Immunogen: human IgA Research Area: Immunology
Description: Antibody raised against Goat human IgA

Goat anti- human IgG
FNab09896	FN Test	100µg	Ask for price
Recommended dilution: WB: 1:1000-1:10000 Immunogen: human IgG Research Area: Immunology
Description: Antibody raised against Goat human IgG

Goat anti- human IgM
FNab09908	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:10000 Immunogen: human IgM Research Area: Immunology
Description: Antibody raised against Goat human IgM

anti- Human IgA antibody
FNab04075	FN Test	100µg	EUR 585
Immunogen: immunoglobulin heavy constant alpha 1 Research Area: Immunology, Signal Transduction, cancer, stem cells, Metabolism
Description: Antibody raised against Human IgA

anti- Human IgA antibody
FNab04076	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:5000-1:50000 IHC: 1:20000-1:100000 Immunogen: immunoglobulin heavy constant alpha 1 Research Area: Immunology, Signal Transduction, cancer, stem cells, Metabolism
Description: Antibody raised against Human IgA

anti- Human IgG antibody
FNab04077	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:2000-1:20000 Immunogen: Human IgG Research Area: Immunology, Signal Transduction, cancer, stem cells, Metabolism
Description: Antibody raised against Human IgG

Goat Anti-Human Albumin
GAHA85-0100	Equitech	100ml	EUR 336.7
Goat Anti-Human Albumin is indicated as RUO. Do not use on humans.

Goat Anti-Human Albumin
GAHA85-0500	Equitech	500ml	EUR 643.5
Goat Anti-Human Albumin is indicated as RUO. Do not use on humans.

Goat, anti-human IgA
IM140	Cygnus Technologies	1 ml	EUR 359
Product category: Antibodies
Description: Goat, anti-human IgA by Cygnus Technologies is available in Europe via Gentaur.

Goat, anti-human IgD
IM141	Cygnus Technologies	1 ml	EUR 359
Product category: Antibodies
Description: Goat, anti-human IgD by Cygnus Technologies is available in Europe via Gentaur.

Goat, anti-human IgE
IM142	Cygnus Technologies	1 ml	EUR 359
Product category: Antibodies
Description: Goat, anti-human IgE by Cygnus Technologies is available in Europe via Gentaur.

Goat, anti-human IgM
IM144	Cygnus Technologies	1 ml	EUR 359
Product category: Antibodies
Description: Goat, anti-human IgM by Cygnus Technologies is available in Europe via Gentaur.

Anti-Human IgG1:HRP
IM151	Cygnus Technologies	1 ml	EUR 322
Product category: Antibodies
Description: Anti-Human IgG1:HRP by Cygnus Technologies is available in Europe via Gentaur.

Anti-Human IgG2:HRP
IM152	Cygnus Technologies	1 ml	EUR 322
Product category: Antibodies
Description: Anti-Human IgG2:HRP by Cygnus Technologies is available in Europe via Gentaur.

Anti-Human IgG3:HRP
IM153	Cygnus Technologies	1 ml	EUR 322
Product category: Antibodies
Description: Anti-Human IgG3:HRP by Cygnus Technologies is available in Europe via Gentaur.

Anti-Human IgG4:HRP
IM154	Cygnus Technologies	1 ml	EUR 359
Product category: Antibodies
Description: Anti-Human IgG4:HRP by Cygnus Technologies is available in Europe via Gentaur.

Sheep, Anti-human IgG4
IM154U	Cygnus Technologies	1 ml	EUR 506
Product category: Antibodies
Description: Sheep, Anti-human IgG4 by Cygnus Technologies is available in Europe via Gentaur.

Anti-TRAIL (human) Antibody
A00466-2	BosterBio	100ul	EUR 417
Description: Rabbit Polyclonal TRAIL (human) Antibody. Validated in IF, IHC and tested in Human.

Anti-CCR4 (human) Antibody
A00755-1	BosterBio	200ug	EUR 397
Description: Goat Polyclonal CCR4 (human) Antibody. Validated in IF, IHC and tested in Human.

Anti-CCR10 (human) Antibody
A04731	BosterBio	200ug	EUR 397
Description: Goat Polyclonal CCR10 (human) Antibody. Validated in ELISA, IF, IHC and tested in Human.

Goat anti Human IgE
70R-IG015	Fitzgerald	1 mg	EUR 349
Description: Affinity purified Goat anti Human IgE antibody

Anti-human Rab5 antibody
A1511-50	Biovision		EUR 465

Anti-human TM9SF4 antibody
A1514-50	Biovision		EUR 446

Anti-human CD9 antibody
A1500-50	Biovision		EUR 465

Anti-human CD63 antibody
A1502-50	Biovision		EUR 490

Anti-human CD41 antibody
A1503-50	Biovision		EUR 468

Anti-human CD81 antibody
A1504-50	Biovision		EUR 468

Anti-human CD44 antibody
A1505-50	Biovision		EUR 468

Anti-human Alix Antibody
A1507-50	Biovision		EUR 501

Anti-human TM9SF4 antibody
A1508-50	Biovision		EUR 468

Anti-human Flotillin antibody
A1510-50	Biovision		EUR 501

Goat anti Human IgG
41C-CB0957	Fitzgerald	5 mg	EUR 346
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41C-CB0972	Fitzgerald	2 mg	EUR 264
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgM
41C-CB0993	Fitzgerald	1 mg	EUR 204
Description: Goat anti Human IgM secondary antibody

Goat anti Human IgG
41R-1026	Fitzgerald	2 mg	EUR 137
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41R-1027	Fitzgerald	2 mg	EUR 186
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41R-1028	Fitzgerald	1 mg	EUR 182
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41R-1029	Fitzgerald	2 mg	EUR 186
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41R-1030	Fitzgerald	1 mg	EUR 138
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41R-1031	Fitzgerald	1 mg	EUR 186
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41R-1032	Fitzgerald	1 mg	EUR 224
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41R-1033	Fitzgerald	1 mg	EUR 246
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41R-1034	Fitzgerald	1 mg	EUR 186
Description: Goat anti Human IgG secondary antibody

Mouse anti Human IgM
41R-1586	Fitzgerald	100 ug	EUR 265
Description: Monoclonal Mouse anti Human IgM antibody

Goat anti Human IgE
40-IG10	Fitzgerald	1 ml	EUR 133
Description: Goat anti Human IgE antibody

Sheep anti Human IgE
40-IG11	Fitzgerald	1 ml	EUR 133
Description: Sheep anti Human IgE antibody

Rabbit anti Human IgG
40C-CB0943	Fitzgerald	1 mg	EUR 249
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG
40C-CB0950	Fitzgerald	5 mg	EUR 381
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG
40C-CB0971	Fitzgerald	2 mg	EUR 322
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgM
40C-CB9100	Fitzgerald	2 mg	EUR 283
Description: Rabbit anti Human IgM secondary antibody

Rabbit anti Human IgA
40C-CB9114	Fitzgerald	2 mg	EUR 259
Description: Rabbit anti Human IgA secondary antibody

Sheep anti Human IgM
40C-CR2023S	Fitzgerald	1 ml	EUR 241
Description: Sheep anti Human IgM antibody

Mouse anti Human IgE
40R-1000	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgE antibody

Mouse anti Human IgA
40R-1001	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgA antibody

Mouse anti Human IgG
40R-1003	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgG antibody

Mouse anti Human IgE
40R-1004	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgE antibody

Mouse anti Human IgM
40R-1005	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgM antibody

Mouse anti Human IgA
40R-1006	Fitzgerald	100 ug	EUR 265
Description: Mouse anti Human IgA antibody

Rat anti Human IgG1
40R-1007	Fitzgerald	100 ug	EUR 265
Description: Rat monoclonal Rat anti Human IgG1 antibody

Mouse anti Human IgA
40R-1011	Fitzgerald	500 ug	EUR 565
Description: Mouse anti Human IgA secondary antibody

Mouse anti Human IgA
40R-1012	Fitzgerald	500 ug	EUR 565
Description: Mouse anti Human IgA secondary antibody

Mouse anti Human IgG3
40R-1015	Fitzgerald	1 mg	EUR 414
Description: Mouse anti Human IgG3 antibody

Rat anti Human IgG
40R-1588	Fitzgerald	100 ug	EUR 265
Description: Rat monoclonal Rat anti Human IgG antibody

Goat anti Human IgG
41-XG56	Fitzgerald	1 mg	EUR 101
Description: Goat anti Human IgG secondary antibody

Mouse anti Human IgM
10C-CR2023M2	Fitzgerald	1 mg	EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM
10C-CR2023M3	Fitzgerald	1 mg	EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgA
10C-CR6043M1	Fitzgerald	1 mg	EUR 241
Description: Mouse anti Human IgA antibody

Mouse anti Human IgE
10C-CR6046M3	Fitzgerald	1 mg	EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10C-CR6046M4	Fitzgerald	1 mg	EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE
10C-CR6046M5	Fitzgerald	1 mg	EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgG
10C-CR6047M1	Fitzgerald	1 mg	EUR 176
Description: Mouse anti Human IgG antibody