February 24, 2021
sysbio

Characterization of differentially expressed plasma proteins in sufferers

Prediction of Radioresistant Prostate Most cancers Primarily based on Differentially Expressed Proteins

Introduction: 

Though relapses after radiotherapy are widespread in prostate most cancers (PCA) sufferers, these with a excessive threat for radioresistance can’t be recognized previous to remedy but. Due to this fact, this proof-of-concept examine was carried out to check protein expression profiles of sufferers with radio-recurrent PCA to sufferers handled with major radical prostatectomy separated by Gleason threat teams. We hypothesized that radio-recurrent PCA have an identical protein expression as high-risk Gleason PCA.

Strategies:

Affected person cohorts consisted of (i) 31 sufferers handled with salvage prostatectomy for regionally recurrent PCA after major radiotherapy and (ii) 94 sufferers handled with major prostatectomy break up right into a Gleason high-risk (≥4 + 3; n = 42 [44.7%]) versus a low-risk group (≤3 + 4; n = 52 [55.3%]). Immunohistochemistry was carried out utilizing 15 antibodies with identified affiliation to radioresistance in PCA in vitro. ELISA was used for validation of chosen markers in serum.

Outcomes: 

Androgen receptor (AR) was overexpressed in most radio-recurrent PCA (89.7%) and in most major high-risk Gleason PCA (87.8%; p = 0.851), whereas solely 67.3% of the low-risk group confirmed an expression (p = 0.017). Contemplating the best Gleason sample in major PCA, aldo-keto reductase household 1 member C3 (AKR1C3) was most equally expressed by sufferers with radio-recurrent PCA and sufferers with Gleason patterns Four and 5 (p = 0.827 and p = 0.893) in comparison with Gleason sample 3 (p = 0.20). These findings have been supported by ELISA.

Conclusion:

That is the primary examine to judge protein markers in an effort to predict radioresistance in PCA. Our outcomes level to AR and AKR1C3 as probably the most promising markers which may assist stratify sufferers for radiotherapy.

The ribotoxin-like protein Ostreatin from Pleurotus ostreatus fruiting our bodies: Affirmation of a novel ribonuclease household expressed in basidiomycetes

Fungi produce a number of toxins lively towards vegetation, animal or people. Amongst them, ribotoxins are enzymes that particularly assault ribosomes irreparably compromising protein synthesis, helpful as pesticides or as anticancer brokers. Right here, a novel ribotoxin from the edible mushroom Pleurotus ostreatus has been purified and characterised.

This ribotoxin, named Ostreatin, is a selected ribonuclease releasing α-fragment when incubated with yeast or rabbit ribosomes. Ostreatin reveals IC50 of 234 pM in rabbit reticulocyte lysate, and steel dependent endonuclease exercise.

Following the completion of Ostreatin major construction, we ascertained that this toxin is homologous to Ageritin, the primary ribotoxin-like protein from the basidiomycete Agrocybe aegerita, with which it shares 38.8% amino acid sequence id.

 Ostreatin consists of 131 amino acid residues with an experimental molecular mass of 14,263.51 Da ([M+H+]+). Homology modeling revealed that Ostreatin and Ageritin share an identical fold through which the widespread catalytic triad is conserved.

Purified Ostreatin lacks N-terminal and C-terminal peptides, which as an alternative are current within the Ostreatin coding sequence. Such peptides are in all probability concerned in protein sorting and for this they may very well be eliminated. Our findings affirm the presence of ribotoxin-like proteins in basidiomycetes edible mushrooms, that we suggest as novel device for biotechnological purposes.

sysbio
sysbio
Human CCL-5 ELISA Kit
EHC0240 96Tests
EUR 521
AXYGEN® HORIZONTAL GEL BOX, 15 CM
HGB-15 1/pk
EUR 486
Description: Lab Equipment; Axygen Branded EQ
DiagNano Fluorophore Labeled Gold Nanoparticles, 15 nm
GFL-15 1 mL
EUR 1053
AXYGEN® GEL TRAY 15 X 15 CM FOR USE WITH 15 CM GEL BOX, UV TRANSPARENT
HGB15-15-GT 1/pk
EUR 79
Description: Lab Equipment; Axygen Branded EQ
DiagNano Gold Nanoparticle Passive Conjugation Kit, 15 nm
GPK-15 1 kit
EUR 715
Anti-Human IgG
DB173RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Human IgG
DB174RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Goat CCL-5 ELISA Kit
EGTC0240 96Tests
EUR 521
Bovine CCL-5 ELISA Kit
EBC0240 96Tests
EUR 521
Canine CCL-5 ELISA Kit
ECC0240 96Tests
EUR 521
Chicken CCL-5 ELISA Kit
ECKC0240 96Tests
EUR 521
Anserini CCL-5 ELISA Kit
EAC0240 96Tests
EUR 521
Mouse CCL-5 ELISA Kit
EMC0240 96Tests
EUR 521
Rat CCL-5 ELISA Kit
ERC0240 96Tests
EUR 521
Sheep CCL-5 ELISA Kit
ESC0240 96Tests
EUR 521
Rabbit CCL-5 ELISA Kit
ERTC0240 96Tests
EUR 521
Monkey CCL-5 ELISA Kit
EMKC0240 96Tests
EUR 521
Porcine CCL-5 ELISA Kit
EPC0240 96Tests
EUR 521
Anti-Human Kappa Light Chain
DB037RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Human Kappa Light Chain
DB038RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Human Lambda Light Chain
DB039RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Guinea Pig CCL-5 ELISA Kit
EGC0240 96Tests
EUR 521
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
Anti-iNOS
DB003RTU-15 15 ml
EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-p53
DB026RTU-15 15 ml
EUR 338
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD5
DB027RTU-15 15 ml
EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD20
DB041RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD45
DB042RTU-15 15 ml
EUR 338
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD163
DB045RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Melanosome
DB049RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD10
DB057RTU-15 15 ml
EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD117
DB062RTU-15 15 ml
EUR 338
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD1a
DB071RTU-15 15 ml
EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD3
DB082RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD8
DB085RTU-15 15 ml
EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-EGFR
DB092RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD7
DB114RTU-15 15 ml
EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-MSH2
DB115RTU-15 15 ml
EUR 400
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-p63
DB134RTU-15 15 ml
EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD23
DB135RTU-15 15 ml
EUR 429
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Desmin
DB148RTU-15 15 ml
EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-CD34
DB151RTU-15 15 ml
EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-p16
DB152RTU-15 15 ml
EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Synaptophysin
DB156RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Braf
DB159RTU-15 15 ml
EUR 709
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-p60
DB203RTU-15 15 ml
EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
anti-Cytokeratin 15
YF-PA12886 100 ul
EUR 403
Description: Rabbit polyclonal to Cytokeratin 15
anti-Cytokeratin 15
YF-PA12887 100 ug
EUR 403
Description: Rabbit polyclonal to Cytokeratin 15
anti-Claudin 15
YF-PA18066 50 ug
EUR 363
Description: Mouse polyclonal to Claudin 15
anti-Claudin 15
YF-PA18067 100 ug
EUR 403
Description: Rabbit polyclonal to Claudin 15
anti-Kallikrein 15
YF-PA19752 50 ul
EUR 363
Description: Mouse polyclonal to Kallikrein 15
anti-Calpain 15
YF-PA24745 50 ul
EUR 334
Description: Mouse polyclonal to Calpain 15
DiagNano Gold Nanoparticle Medium Covalent Conjugation Kit, 15 nm
GCK-M-15 1 kit
EUR 757
DiagNano Fluorophore Labeled Gold Nanoparticles, 15 nm, Cellular Uptake
GFL-15-CU 1mL
EUR 1365
Anti-Human GCDFP-15 antibody
STJ16100371 1 mL
EUR 956
Anti-b-actin
DB001RTU-15 15 ml
EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Melan A
DB050RTU-15 15 ml
EUR 302
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 7
DB051RTU-15 15 ml
EUR 309
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-S-100
DB055RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cyclin D1
DB066RTU-15 15 ml
EUR 414
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Ki-67
DB070RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-TTF-1
DB089RTU-15 15 ml
EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 8
DB098RTU-15 15 ml
EUR 309
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 14
DB099RTU-15 15 ml
EUR 302
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 16
DB100RTU-15 15 ml
EUR 302
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 17
DB101RTU-15 15 ml
EUR 302
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 18
DB102RTU-15 15 ml
EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 19
DB103RTU-15 15 ml
EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-C3d complement
DB106RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-C4d complement
DB107RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Ki-67
DB111RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 20
DB119RTU-15 15 ml
EUR 309
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Chromogranin A
DB158RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-P504S (AMACR)
DB208RTU-15 15 ml
EUR 340
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-ER (Estrogen Receptor)
DB053RTU-15 15 ml
EUR 406
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-PR (Progesterone Receptor)
DB059RTU-15 15 ml
EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-EBV/LMP-1
DB060RTU-15 15 ml
EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-EBV/LMP-1
DB061RTU-15 15 ml
EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 5/6
DB097RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-PR (Progesterone Receptor)
DB108RTU-15 15 ml
EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-PR (Progesterone Receptor)
DB109RTU-15 15 ml
EUR 428
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-p16 (mouse monoclonal)
DB253RTU-15 15 ml
EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-PLAP (Placental Alkaline Phosphatase)
DB047RTU-15 15 ml
EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-EMA (CD227, Mucin-1)
DB048RTU-15 15 ml
EUR 265
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Alpha Smooth Muscle Actin
DB147RTU-15 15 ml
EUR 347
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)
Anti-Cytokeratin 15 Antibody
A06791 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Cytokeratin 15 Antibody (KRT15) detection.tested for WB in Human, Mouse, Rat, Monkey.
Anti-DHHC-15 Antibody
A12099 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DHHC-15 Antibody (ZDHHC15) detection. Tested with WB in Human.
Anti-MMP-15 Antibody
A06396 100ul
EUR 397
Description: Rabbit Polyclonal MMP-15 Antibody. Validated in WB and tested in Human, Mouse.
anti- Cytokeratin 15 antibody
FNab02198 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: keratin 15
  • Uniprot ID: P19012
  • Gene ID: 3866
  • Research Area: Cancer, Immunology
Description: Antibody raised against Cytokeratin 15
anti- Cytokeratin 15 antibody
FNab02199 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • Immunogen: keratin 15
  • Uniprot ID: P19012
  • Gene ID: 3866
  • Research Area: Cancer, Immunology
Description: Antibody raised against Cytokeratin 15
anti-CDC2 (Ab-15)
LF-PA20070 100 ul
EUR 334
Description: Rabbit polyclonal to CDC2
anti-HSP27 (Ab-15)
LF-PA20219 100 ul
EUR 334
Description: Rabbit polyclonal to HSP27
anti-p53 (Ab-15)
LF-PA20358 100 ul
EUR 334
Description: Rabbit polyclonal to p53
Anti-Cytokeratin 15 antibody
PAab02198 100 ug
EUR 355
Anti-GCDFP-15 antibody
STJ16100370 1 mL
EUR 813
Anti-Cytokeratin 15 antibody
STJ92628 200 µl
EUR 197
Description: Rabbit polyclonal to Cytokeratin 15.
Anti-DHHC-15 antibody
STJ92707 200 µl
EUR 197
Description: Rabbit polyclonal to DHHC-15.
Anti-GDF-15 antibody
STJ93253 200 µl
EUR 197
Description: Rabbit polyclonal to GDF-15.
Anti-MMP-15 antibody
STJ94276 200 µl
EUR 197
Description: Rabbit polyclonal to MMP-15.
Anti-PEA-15 antibody
STJ95018 200 µl
EUR 197
Description: Rabbit polyclonal to PEA-15.
Anti-PEA-15 antibody
STJ95019 200 µl
EUR 197
Description: Rabbit polyclonal to PEA-15.
Anti-PEA-15 antibody
STJ95020 200 µl
EUR 197
Description: Rabbit polyclonal to PEA-15.
Anti-GCDFP-15 antibody
STJ180109 0.1 ml
EUR 213
Anti-GCDFP-15 antibody
STJ180290 0.1 ml
EUR 212
Anti-CK-15 antibody
STJ190030 200 µl
EUR 197
Description: Unconjugated Mouse monoclonal to CK-15 (5A1)
Anti-BMP-15 antibody
STJ97345 200 µl
EUR 197
Description: Rabbit polyclonal to BMP-15.
Anti-Cytokeratin 15 antibody
STJ97982 100 µl
EUR 234
Description: Mouse monoclonal to Cytokeratin 15.
Anti-IL-15 antibody
STJ99006 200 µl
EUR 197
Description: Rabbit polyclonal to IL-15.
Anti-Calpain 15 (4E2)
YF-MA15522 100 ug
EUR 363
Description: Mouse monoclonal to Calpain 15
Anti-Calpain 15 (2H7)
YF-MA15523 100 ug
EUR 363
Description: Mouse monoclonal to Calpain 15
anti-15 Lipoxygenase 1
YF-PA10168 100 ug
EUR 403
Description: Rabbit polyclonal to 15 Lipoxygenase 1
anti-Protease Inhibitor 15
YF-PA18816 50 ul
EUR 363
Description: Mouse polyclonal to Protease Inhibitor 15
Anti-GDF-15 Antibody
A2038-100 100 µl
EUR 419
TruStrip Sample Transfer Strips, 15-ul, 50/Pk (without sample tracking dye)
STS-15-50 1 Pk Ask for price
TruStrip Sample Transfer Strips, 15-ul, 50/Pk (with sample tracking dye)
STSD-15-50 1 Pk Ask for price
Anti-Human IgG
DB-173-RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Characterization of differentially expressed plasma  proteins in sufferers with acute myocardial infarction

Acute myocardial infarction (AMI) stays a number one reason behind morbidity and mortality worldwide. Novel biomarkers are wanted to determine NSTEMI in AMI sufferers. The examine goal was to make use of proteomics to determine novel plasma biomarkers for STEMI and NSTEMI sufferers. iTRAQ evaluation was carried out on pooled samples from Eight wholesome controls and 12 STEMI and 12 NSTEMI sufferers.

 Bioinformatics evaluation recognized 95 differentially expressed proteins that have been differentially expressed within the plasma of AMI sufferers and wholesome controls; 28 of those proteins have been present in STEMI/Con (22 upregulated and 6 downregulated), 48 in NSTEMI/Con (12 upregulated and 36 downregulated), and 44 in NSTEMI/STEMI (11 upregulated and 33 downregulated).

  • Protein community evaluation was then carried out utilizing STRING software program. Practical evaluation revealed that the recognized plasma proteins have been primarily concerned with carbon metabolism, toll-like receptor signaling pathway, and hypertrophic cardiomyopathy.
  • 9 of the proteins (SSA1, MDH1, FCN2, GPI, S100A8, LBP, vinculin, VDBP, and RBP4) that modified ranges throughout AMI development have been additional validated by ELISA. The constructed plasma proteome may replicate the AMI pathogenesis molecular mechanisms and supply a technique for the early identification of NSTEMI in AMI sufferers. SIGNIFICANCE:

The purpose of this examine was to make use of proteomics to determine novel predictive plasma biomarkers for sufferers with acute myocardial infarction (AMI), which might enable for both identification of people susceptible to an infarction, and early identification of NSTEMI in sufferers with AMI. Utilizing an strategy that mixed iTRAQ with LC-MS/MS, we discovered 95 proteins that confirmed vital variations in expression ranges among the many AMI sufferers and wholesome controls.

The proteins SSA1, MDH1, FCN2, GPI, S100A8, LBP, vinculin, VDBP, and RBP4 have been discovered to play essential roles within the pathogenesis of AMI. Utilizing bioinformatics evaluation, we discovered that dysregulation of carbon metabolism, toll-like receptor signaling pathway, and hypertrophic cardiomyopathy will be the main driving forces for cardiac injury throughout myocardial infarction.

Nonetheless, additional investigations are wanted to confirm the mechanisms concerned within the growth of AMI particularly NSTEMI. Taken collectively, our findings lay the inspiration for understanding the molecular mechanisms underlying the pathogenic processes of AMI, and counsel potential purposes for particular biomarkers in early prognosis and willpower of prognosis.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Human KIR2DL4 ELISA KIT

ELI-21303h 96 Tests
EUR 824

Human KIR2DL4 shRNA Plasmid

20-abx952576
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KIR2DL4 Recombinant Protein (Human)

RP017041 100 ug Ask for price

KIR2DL4 Rabbit pAb

A12836-100ul 100 ul
EUR 308

KIR2DL4 Rabbit pAb

A12836-200ul 200 ul
EUR 459

KIR2DL4 Rabbit pAb

A12836-20ul 20 ul
EUR 183

KIR2DL4 Rabbit pAb

A12836-50ul 50 ul
EUR 223

KIR2DL4 Blocking Peptide

33R-9831 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIR2DL4 antibody, catalog no. 70R-2365

KIR2DL4 Polyclonal Antibody

27806-100ul 100ul
EUR 252

KIR2DL4 Polyclonal Antibody

27806-50ul 50ul
EUR 187

KIR2DL4 cloning plasmid

CSB-CL857457HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgtccatgtcacccacggtcatcatcctggcatgtcttgggttcttcttggaccagagtgtgtgggcacacgtgggtggtcaggacaagcccttctgctctgcctggcccagcgctgtggtgcctcaaggaggacacgtgactcttcggtgtcactatcgtcgtgggtttaaca
  • Show more
Description: A cloning plasmid for the KIR2DL4 gene.

pOTB7-KIR2DL4 Plasmid

PVTB00348 2 ug
EUR 356

KIR2DL4 ORF Vector (Human) (pORF)

ORF005681 1.0 ug DNA
EUR 95

KIR2DL4 Polyclonal Conjugated Antibody

C27806 100ul
EUR 397

pEGFP-flag-KIR2DL4 Plasmid

PVTB00348-2a 2 ug
EUR 356

KIR2DL4 sgRNA CRISPR Lentivector set (Human)

K1150301 3 x 1.0 ug
EUR 339

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody

20-abx339417
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody

20-abx210854
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody

1-CSB-PA246816
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody

1-CSB-PA205578
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1150302 1.0 ug DNA
EUR 154

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1150303 1.0 ug DNA
EUR 154

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1150304 1.0 ug DNA
EUR 154

Recombinant Human KIR2DL4 Protein, His, Insect-1ug

QP12489-1ug 1ug
EUR 155

Recombinant Human KIR2DL4 Protein, His, Insect-50ug

QP12489-50ug 50ug
EUR 1261

Recombinant Human KIR2DL4 Protein, His, Insect-5ug

QP12489-5ug 5ug
EUR 201

KIR2DL4 Protein Vector (Human) (pPB-C-His)

PV022721 500 ng
EUR 329

KIR2DL4 Protein Vector (Human) (pPB-N-His)

PV022722 500 ng
EUR 329

KIR2DL4 Protein Vector (Human) (pPM-C-HA)

PV022723 500 ng
EUR 329

KIR2DL4 Protein Vector (Human) (pPM-C-His)

PV022724 500 ng
EUR 329

KIR2DL4 3'UTR Luciferase Stable Cell Line

TU011796 1.0 ml
EUR 1521

KIR2DL4 3'UTR GFP Stable Cell Line

TU061796 1.0 ml
EUR 1521

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1150305 3 x 1.0 ug
EUR 376

Killer Cell Immunoglobulin-Like Receptor 2DL4 (KIR2DL4) Antibody

abx145740-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1150306 1.0 ug DNA
EUR 167

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1150307 1.0 ug DNA
EUR 167

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1150308 1.0 ug DNA
EUR 167

KIR2DL4 Killer Cell Immunoglobulin-Like Receptor, 2 Domains Long Cytoplasmic Tail 4 Human Recombinant Protein

PROTQ99706 Regular: 5ug
EUR 317
Description: KIR2DL4 Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 458 amino acids (24-242 a.a.) and having a molecular mass of 51kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). KIR2DL4 is expressed with a 239 amino acids hIgG-His tag at C-Terminus and purified by proprietary chromatographic techniques. 

anti-human RecQL4

AR05-PA0007 100 ul
EUR 334
Description: Rabbit polyclonal to human RecQL4

anti-human CCR1

20R-3028 200 ug
EUR 587
Description: Goat anti-human CCR1 antibody

Anti-Human IgG

DB-173-0.1 100 μl
EUR 212
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-0.2 200 μl
EUR 298
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-0.5 500 μl
EUR 384
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-1 1 ml
EUR 613
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB-173-RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB-174-0.1 100 μl
EUR 212
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-0.2 200 μl
EUR 298
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-0.5 500 μl
EUR 384
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-1 1 ml
EUR 613
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB-174-RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB173RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB173RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB174RTU-15 15 ml
EUR 355
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB174RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

anti-human Albumin

LF-PA10001 100 ug
EUR 403
Description: Rabbit polyclonal to human Albumin

Goat anti-Human anti-thrombin polyclonal antibody

CABT-L487 500ug
EUR 715

Sheep anti-Human anti-thrombin polyclonal antibody

CABT-L488 500ug
EUR 663

Sheep anti-Human anti-thrombin polyclonal antibody

CABT-L489 100ug
EUR 663

Sheep anti-Human anti-thrombin polyclonal antibody

CABT-L490 100ug
EUR 663

Sheep anti-Human anti-thrombin polyclonal antibody

CABT-L491 100ug
EUR 663

Human anti-TPO(anti-thrombopoietin) ELISA Kit

EH4147 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Alias: anti-TPO
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens ;Sensitivity: 0.938 ng/ml

Human anti AMPH(anti amphiphysin) ELISA Kit

EH2621 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P49418
  • Alias: anti-AMPH
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *

V100125 50 ug
EUR 306
  • R-phrase:
  • H-Phrase:
  • Symbol for dangerous compounds:
  • UNSPEC Code:

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *

V100126 1 mg
EUR 393
  • R-phrase:
  • H-Phrase:
  • Symbol for dangerous compounds:
  • UNSPEC Code:

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat Anti-Human IgA

C020242-1mg 1mg
EUR 227

Goat Anti-Human IgA

C020242-50mg 50mg
EUR 2635

Rabbit Anti Human IgG

E61I00101 100ug
EUR 343

Goat Anti Human IgG

E61I00201 1mg
EUR 274

Goat Anti Human IgM

E61I00401 100ug
EUR 343

Mouse Anti Human IgM

E61I00402 100ug
EUR 343

Goat anti human IgA

E61I01201 1mg
EUR 611

Mouse anti human IgA

E61I02101 100ug
EUR 343

Goat anti human IgA

E61I02102 100ug
EUR 343

Mouse anti human IgE

E61I02201 100ug
EUR 343

Anti-Human IgG:HRP Conjugate

F163 12 ml
EUR 488
  • Product category: Antibodies
Description: Anti-Human IgG:HRP Conjugate by Cygnus Technologies is available in Europe via Gentaur.

Goat anti- human IgA

FNab09895 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:10000
  • Immunogen: human IgA
  • Research Area: Immunology
Description: Antibody raised against Goat human IgA

Goat anti- human IgG

FNab09896 100µg Ask for price
  • Recommended dilution: WB: 1:1000-1:10000
  • Immunogen: human IgG
  • Research Area: Immunology
Description: Antibody raised against Goat human IgG

Goat anti- human IgM

FNab09908 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:10000
  • Immunogen: human IgM
  • Research Area: Immunology
Description: Antibody raised against Goat human IgM

anti- Human IgA antibody

FNab04075 100µg
EUR 585
  • Immunogen: immunoglobulin heavy constant alpha 1
  • Research Area: Immunology, Signal Transduction, cancer, stem cells, Metabolism
Description: Antibody raised against Human IgA

anti- Human IgA antibody

FNab04076 100µg
EUR 585
  • Recommended dilution: WB: 1:5000-1:50000
  • IHC: 1:20000-1:100000
  • Immunogen: immunoglobulin heavy constant alpha 1
  • Research Area: Immunology, Signal Transduction, cancer, stem cells, Metabolism
Description: Antibody raised against Human IgA

anti- Human IgG antibody

FNab04077 100µg
EUR 585
  • Recommended dilution: WB: 1:2000-1:20000
  • Immunogen: Human IgG
  • Research Area: Immunology, Signal Transduction, cancer, stem cells, Metabolism
Description: Antibody raised against Human IgG

Goat Anti-Human Albumin

GAHA85-0100 100ml
EUR 336.7
  • Goat Anti-Human Albumin is indicated as RUO. Do not use on humans.

Goat Anti-Human Albumin

GAHA85-0500 500ml
EUR 643.5
  • Goat Anti-Human Albumin is indicated as RUO. Do not use on humans.

Goat, anti-human IgA

IM140 1 ml
EUR 359
  • Product category: Antibodies
Description: Goat, anti-human IgA by Cygnus Technologies is available in Europe via Gentaur.

Goat, anti-human IgD

IM141 1 ml
EUR 359
  • Product category: Antibodies
Description: Goat, anti-human IgD by Cygnus Technologies is available in Europe via Gentaur.

Goat, anti-human IgE

IM142 1 ml
EUR 359
  • Product category: Antibodies
Description: Goat, anti-human IgE by Cygnus Technologies is available in Europe via Gentaur.

Goat, anti-human IgM

IM144 1 ml
EUR 359
  • Product category: Antibodies
Description: Goat, anti-human IgM by Cygnus Technologies is available in Europe via Gentaur.

Anti-Human IgG1:HRP

IM151 1 ml
EUR 322
  • Product category: Antibodies
Description: Anti-Human IgG1:HRP by Cygnus Technologies is available in Europe via Gentaur.

Anti-Human IgG2:HRP

IM152 1 ml
EUR 322
  • Product category: Antibodies
Description: Anti-Human IgG2:HRP by Cygnus Technologies is available in Europe via Gentaur.

Anti-Human IgG3:HRP

IM153 1 ml
EUR 322
  • Product category: Antibodies
Description: Anti-Human IgG3:HRP by Cygnus Technologies is available in Europe via Gentaur.

Anti-Human IgG4:HRP

IM154 1 ml
EUR 359
  • Product category: Antibodies
Description: Anti-Human IgG4:HRP by Cygnus Technologies is available in Europe via Gentaur.

Sheep, Anti-human IgG4

IM154U 1 ml
EUR 506
  • Product category: Antibodies
Description: Sheep, Anti-human IgG4 by Cygnus Technologies is available in Europe via Gentaur.

Anti-TRAIL (human) Antibody

A00466-2 100ul
EUR 417
Description: Rabbit Polyclonal TRAIL (human) Antibody. Validated in IF, IHC and tested in Human.

Anti-CCR4 (human) Antibody

A00755-1 200ug
EUR 397
Description: Goat Polyclonal CCR4 (human) Antibody. Validated in IF, IHC and tested in Human.

Anti-CCR10 (human) Antibody

A04731 200ug
EUR 397
Description: Goat Polyclonal CCR10 (human) Antibody. Validated in ELISA, IF, IHC and tested in Human.

Goat anti Human IgE

70R-IG015 1 mg
EUR 349
Description: Affinity purified Goat anti Human IgE antibody

Anti-human Rab5 antibody

A1511-50
EUR 465

Anti-human TM9SF4 antibody

A1514-50
EUR 446

Anti-human CD9 antibody

A1500-50
EUR 465

Anti-human CD63 antibody

A1502-50
EUR 490

Anti-human CD41 antibody

A1503-50
EUR 468

Anti-human CD81 antibody

A1504-50
EUR 468

Anti-human CD44 antibody

A1505-50
EUR 468

Anti-human Alix Antibody

A1507-50
EUR 501

Anti-human TM9SF4 antibody

A1508-50
EUR 468

Anti-human Flotillin antibody

A1510-50
EUR 501

Goat anti Human IgG

41C-CB0957 5 mg
EUR 346
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG

41C-CB0972 2 mg
EUR 264
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgM

41C-CB0993 1 mg
EUR 204
Description: Goat anti Human IgM secondary antibody

Goat anti Human IgG

41R-1026 2 mg
EUR 137
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG

41R-1027 2 mg
EUR 186
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG

41R-1028 1 mg
EUR 182
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG

41R-1029 2 mg
EUR 186
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG

41R-1030 1 mg
EUR 138
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG

41R-1031 1 mg
EUR 186
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG

41R-1032 1 mg
EUR 224
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG

41R-1033 1 mg
EUR 246
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG

41R-1034 1 mg
EUR 186
Description: Goat anti Human IgG secondary antibody

Mouse anti Human IgM

41R-1586 100 ug
EUR 265
Description: Monoclonal Mouse anti Human IgM antibody

Goat anti Human IgE

40-IG10 1 ml
EUR 133
Description: Goat anti Human IgE antibody

Sheep anti Human IgE

40-IG11 1 ml
EUR 133
Description: Sheep anti Human IgE antibody

Rabbit anti Human IgG

40C-CB0943 1 mg
EUR 249
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG

40C-CB0950 5 mg
EUR 381
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG

40C-CB0971 2 mg
EUR 322
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgM

40C-CB9100 2 mg
EUR 283
Description: Rabbit anti Human IgM secondary antibody

Rabbit anti Human IgA

40C-CB9114 2 mg
EUR 259
Description: Rabbit anti Human IgA secondary antibody

Sheep anti Human IgM

40C-CR2023S 1 ml
EUR 241
Description: Sheep anti Human IgM antibody

Mouse anti Human IgE

40R-1000 100 ug
EUR 265
Description: Mouse anti Human IgE antibody

Mouse anti Human IgA

40R-1001 100 ug
EUR 265
Description: Mouse anti Human IgA antibody

Mouse anti Human IgG

40R-1003 100 ug
EUR 265
Description: Mouse anti Human IgG antibody

Mouse anti Human IgE

40R-1004 100 ug
EUR 265
Description: Mouse anti Human IgE antibody

Mouse anti Human IgM

40R-1005 100 ug
EUR 265
Description: Mouse anti Human IgM antibody

Mouse anti Human IgA

40R-1006 100 ug
EUR 265
Description: Mouse anti Human IgA antibody

Rat anti Human IgG1

40R-1007 100 ug
EUR 265
Description: Rat monoclonal Rat anti Human IgG1 antibody

Mouse anti Human IgA

40R-1011 500 ug
EUR 565
Description: Mouse anti Human IgA secondary antibody

Mouse anti Human IgA

40R-1012 500 ug
EUR 565
Description: Mouse anti Human IgA secondary antibody

Mouse anti Human IgG3

40R-1015 1 mg
EUR 414
Description: Mouse anti Human IgG3 antibody

Rat anti Human IgG

40R-1588 100 ug
EUR 265
Description: Rat monoclonal Rat anti Human IgG antibody

Goat anti Human IgG

41-XG56 1 mg
EUR 101
Description: Goat anti Human IgG secondary antibody

Mouse anti Human IgM

10C-CR2023M2 1 mg
EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgM

10C-CR2023M3 1 mg
EUR 154
Description: Mouse anti Human IgM antibody

Mouse anti Human IgA

10C-CR6043M1 1 mg
EUR 241
Description: Mouse anti Human IgA antibody

Mouse anti Human IgE

10C-CR6046M3 1 mg
EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10C-CR6046M4 1 mg
EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgE

10C-CR6046M5 1 mg
EUR 165
Description: Mouse anti Human IgE antibody

Mouse anti Human IgG

10C-CR6047M1 1 mg
EUR 176
Description: Mouse anti Human IgG antibody

Leave a Reply

Your email address will not be published. Required fields are marked *